FAQ – Frequently Asked Questions

Genomics Core

All/
Sample Submission/
Service Requests/
iLab/
non-HKU/
services/

All service requests must be submitted via iLab, an online requests management system. Please contact us to create an account if you don’t already have one.

Please contact our colleagues in advance (via phone/email) before bringing the samples to the Core.

With your samples, please bring along the following items:

  • Hardcopy (and softcopy as attachment in iLab) of the Sample Submission Form of corresponding platform
  • For DNA samples, gel photo with appropriate size marker

Typically we do provide services to non-HKU institutes. Please contact us for details.

Bioinformatics Core

All/
Data analysis/
Data extraction/
Partek Genomics Suite/
sFTP login and download/

Authentication failed; Critical error: Could not connect to serverThis is likely due to username or password may contain some “look-alike” characters, such as “I”, “1”, “0” or “O”. You are suggested to copy and paste the information for connection again.

The error may be caused by your network blocking our sFTP server or unstable network. Please try another network for connection again. Also, due to instability of Wi-Fi, you are highly recommended to download the files with a more stable network connection, such as wired LAN.

The error may be caused by insufficient disk space in your computer or unstable network. Please check if your hard disk has sufficient free space for storing the data. Also, due to instability of Wi-Fi, you are highly recommended to download the files with a more stable network connection, such as wired LAN.

The zip.001 and zip.002 are the split zip files of the original folder. Only zip.001 needs to be extracted and the remaining zip files (zip.002 and/or zip.003 if any) will be unzipped automatically into a single folder. Hence, please do not unzip other zip files except zip.001.

Cannot open the file as [zip] archive

The files may be corrupted due to unsuccessful downloading from our sFTP server. Please ensure that you have followed the instruction to download the files and verify the file integrity with WinMD5Free.

Wrong password


This is likely due to username or password may contain some “look-alike” characters, such as “I”, “1”, “0” or “O”. You are suggested to copy and paste the password for extraction again.

The files may not have extracted successfully due to wrong unzip password. You are suggested to copy and paste the password for extraction again.

Using our recommended extraction software (7zip) will generally solve the error. Please contact us if the error still persists after using 7zip.

For standard analysis, please refer to the deliverable table of different project types. If you would like to have additional deliverables, please contact us for a discussion.

The turnaround time for a standard bioinformatics analysis is around 2 weeks, upon the raw sequencing data is ready and required information (e.g. sample species, comparison list) is received beforehand.

In general, the sequencing data contains adapter sequences. The adapters will only be trimmed upon request in the MiSeq sequencing service.

If you want to trim the adapters for your sequencing data, you may refer to the first pair of adapter sequences in this website.

Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Please remember to check the adapter-trimmed fastq files before the downstream analysis.

The file format of Partek project provided in RNA-Seq analysis will be changed from “.ppj” to “.zip” from July 2021.

To import the project, click “File” -> “Import” -> “Zipped Project…” -> Choose the project to be imported

**Other operations in PGS remain unchanged.

To specify, click “Browse” -> Choose the corresponding text file of your comparison

(e.g. AvsB_Partek_Gene_Diff.txt / AvsB_Partek_Isoform_Diff.txt) -> Click “OK”.

Proteomics and Metabolomics Core

All/
Mass Spectrometry/
PM Core/
Protein contamination/
Protein identification/
Service level/

Generally, the sequence coverage is between 10% and 90% per protein, which is dependent on the protein abundance and protein nature.

Reasons are-
1. Use of a staining method that is not compatible for mass spectrometry detection;
2. The presence of ion suppressing reagents, such as polymers, detergents, and glycerol in the sample;
3. Overloading with contaminating proteins, such as antibodies in affinity purifications, and high abundance proteins in serum samples;
4. Protein specific properties; e.g. heavily modified proteins, very few lysine and arginine residues in a particular protein.
Keratins are the most common protein contaminants derived primarily from human skin and hair, or sometimes from clothes like wool sweaters. These are tips for you to avoid keratin contamination of your sample:
1. Work in a clean lab with clean surfaces;
2. Use pipette tips and microcentrifuge tubes from closed boxes;
3. Rinse equipment in clean water before use (bottles, glass plates, electrophoresis equipment, staining trays);
4. Always wear gloves during your sample preparation and digestion. Never touch the gel with your fingers. Do not touch your hair or skin with gloved hands.

The typical turn around time is 2 weeks for simple Protein Profiling/PTM IDs, routine services for targeted metabolite quantification (GC-MS/MS, and LC-MS/MS); 3 weeks for Protein ID & Quant (Label-free Protein Quantification), 4 Weeks for Label-based (TMT/iTRAQ) protein ID & Quantification months, and 6 weeks for Label based phosphoproteomics services.

Biobank

All/
Biobank/
Management/
Restriction/
Service charge/
Services/
iLab/

Staff within the HKU Faculty of Medicine are eligible and have priority to use the Biobank services. Other HKU staff may enquire through email: biobank.cpos@hku.hk. Long-term freezer storage is only for Staff within the HKU Faculty of Medicine.

The Biobank provides sample storage services and some sample processing services, such as separation of plasma/serum/buffy coat from whole blood, sample aliquot services etc. Please email biobank.cpos@hku.hk to discuss your needs.

The Biobank is established by the LKS Faculty of Medicine as part of its Core Facilities. The day-to-day operation and management of the Biobank is handled by the Centre for PanorOmic Sciences (CPOS) – Biobank Core staff.

Yes, the Biobank will NOT accept the following samples:
    1. WHO Risk Group 3 and 4 microorganisms cultured in the laboratory, e.g. Influenza virus strains such as H5N1 and H7N9, Mycobacterium tuberculosis, Ebola, Marburg, Herpesvirus simiae etc.
    2. High titre stocks of Risk Group 2 microorganisms of known significant risk, e.g. Burkholderia pseudomallei, Bordetella pertussis, Corynebacterium diphtheria, Neisseria meningitides etc.
    3. Clinical or environmental samples that have been confirmed to carry the above mentioned microorganisms.
    4. Radioactive materials

A declaration form with additional details needs to be signed by each P.I. and user prior to using the Biobank.

The Faculty is providing subsidy for the usage of Biobank, while some operating cost is to be recovered based on resources consumed. You may find some standard charges on the “Service Charges” page. For other services, please email biobank.cpos@hku.hk for discussions and quotations.

Please go through the information on this website, then email biobank.cpos@hku.hk

Information to facilitate effective follow-up may include:

  1. Your name, department and phone number
  2. P.I. name, department and email
  3. Samples nature, e.g. whole blood, buffy coat, plasma, serum, DNA, RNA, virus, bacteria
  4. Sample size, source and pathogenicity involved
  5. Storage condition required
  6. For sample storage, current box/vessel types and sizes
  7. Other specific needs

Imaging and Flow Cytometry Core

All/
Data Transfer/
Online Booking System/
Password Reset/

Please refer to the user’s guide Here.

Please refer to the supervisor’s guide Here

  1. Register in the user registration page http://ifcs.cpos.hku.hk/share-drive/create_user.php
    with any Internet browser.

    • Fill in the E-mail with HKU email Only (uid@hku.hk or uid@connect.hku.hk), Do NOT use email alias. Fill in your full name and password
    • Click ‘Register’ to submit and generate a confirmation email which will be sent to your HKU E-mail account.
  1. Check your registered mailbox for email titled “CPOS Imaging and Flow Cytometry Core Network Server Account Registration Confirmation”.
  1. Complete the registration by clicking on the confirmation link in the email received.

Imaging and Flow Cytometry Core Server Connection and Data Uploading Instruction.
Imaging and Flow Cytometry Core Server Connection and Data Uploading Instruction– Linux.

Imaging and Flow Cytometry Core Server Connection and Data Downloading Instruction – Windows 10.

Imaging and Flow Cytometry Core Server Connection and Data Downloading Instruction – Windows 7.

Imaging and Flow Cytometry Core Server Connection and Data Downloading Instruction – Mac.

Imaging and Flow Cytometry Core Server Connection and Data Downloading Instruction– Linux.

Imaging and Flow Cytometry Core SOP – Accessing DTS with Updated Credentials on macOS.

For downloading data from non-HKU network, please connect to HKUVPN prior to mapping the drive in server.

Steps to reset password

  1. Use an Internet browser to open the password reset page at http://ifcs.cpos.hku.hk/share-drive/passwd.php
  2. Enter your HKU email address
  3. Check the link in the password reset email sent to your HKU mailbox and enter your new password in the page to reset your password

Bioreagent Core

All/
Online Ordering System/

Please follow the Staff User guide here 

There are >20 category of common consumables and reagents from >60 well-known brands, Including lab consumables for cell culture, microbiology, imaging & flow cytometry, molecular as well as lab routine operation. Please refer to the Bioreagent Core Online Ordering System (BROS) for the detailed item list.

New item suggestions are welcome. Please provide the desired product details, consummation rate, recent price to contact bioreagent.cpos@hku.hk for our consideration.

The delivery service serves orders from labs in Queen Mary Hospital, Sassoon Road campus including Laboratory Block, JCBIR, CCMR, Chinese Medicine Building. For lab in other location, please arrange self pick up from the Core warehouse within 5 working days from the order confirmed date.

For orders for Laboratory Block, Items in confirmed orders will be delivered within 3 working days. Schedule is subject to change depends on the actual situation. For orders from QMH, JCBIR and buildings along Sassoon Road, weekly delivery will be offer on the fixed date as schedule shown in online ordering system login message. For urgent pick up, please contact us via phone or email.

Item can be Self pick ups for urgent situation. Service available time is 9:30-12:00; 14:00-17:00. Please notice us via phone or email in advance to arrange self pick up. Walk-in self pick up requests will not be entertained.

There are two type of Delivery Notes issued by Bioreagent Core: Consignment Delivery Note and Delivery Note.

Consignment Delivery Note are issued for items for consignment that are distributed by Bioreagent Core. The corresponding vendors will issue invoices to the requester in due course. Upon receive the invoice from vendors, the invoice should be proceeded as direct invoice for the purchase. Payment should be initiated by submitting the endorsed invoice to your department and then HKU FEO.

Delivery Note are issued for items that are retailed by Bioreagent Core. At the beginning of each month, a Monthly Invoice will be issued to group supervisors for all orders collected by the end of the previous month. The charges will be settled by interdepartmental transfer from the funding account provided during order. Payment would be initiated by Core’s submission of the monthly consolidated amount to HKU FEO. Therefore please DO NOT submit the invoice to HKU FEO.

Order with amount exceeding the approval limit should be submitted for supervisor’s approval. To get the order approved, you may either 1) attach in the order an endorsed printing of corresponding IR, or 2) invite your Supervisor to approve the order in the online system by submitting the order to your supervisor, 3) write email to your supervisor for approval of the purchase with carbon copy (cc) to bioreaeagent.cpos@hku.hk.

To amend the Charging Account(s) in an invoice, please send an email to enquiry.cpos@hku.hk within 30 days from the date of the invoice, including the information of 1) Invoice No. 2) Group Name 3) Item Request No. 4) New Charging Account No.

Group Transection Report can be generated on the system for the order, items’ details, account details, unit price, total amount etc. To generate the report, click ‘Group Transection Report’ under ‘Report’ and select appropriate Date, Vendor and Group.

Bioresearch Support Core

All/
Data Transfer/
Online Booking System/
Password Reset/

Please refer to the user’s guide Here.

Please refer to the supervisor’s guide Here

1. Register in the user registration page
http://ifcs.cpos.hku.hk/share-drive/create_user.php with any Internet browser.

  • Fill in the E-mail with HKU email Only (uid@hku.hk or uid@connect.hku.hk), Do NOT use email alias. Fill in your full name and password
  • Click ‘Register’ to submit and generate a confirmation email which will be sent to your HKU E-mail account.
  1. Check your registered mailbox for email titled “CPOS Network Server Account Registration Confirmation”.
  1. Complete the registration by clicking on the confirmation link in the email received

Server Connection and Data Uploading Instruction.

Server Connection and Data Downloading Instruction – Windows 10.

Server Connection and Data Downloading Instruction – Mac.

Bioresearch Support Core SOP – Accessing DTS with Updated Credentials on macOS.

For downloading data from non-HKU network, please connect to HKUVPN prior to mapping the drive in server.

Steps to reset password

  1. Use an Internet browser to open the password reset page at http://ifcs.cpos.hku.hk/share-drive/passwd.php
  2. Enter your HKU email address
  3. Check the link in the password reset email sent to your HKU mailbox and enter your new password in the page to reset your password

Want to stay in the loop? Sign Up to receive our emails

We value your privacy. We never send you any spam or pass your information to 3rd parties.